mpfA [2020-01-26 08:21:34]

magnesium efflux pump, mutation suppresses defects in 70 S ribosome formation

Locus: BSU_09550

Isoelectric point: 4.40

Molecular weight: 49.69 kDa

Protein length: 444 aa

Gene length: 1335 bp

Function: export of magnesium

Product: magnesium efflux pump

Essential: no

Synonyms: yhdP

Genomic Context

Loading

Categories containing this gene/protein

• Cellular processes → Homeostasis → Metal ion homeostasis (K, Na, Ca, Mg) → Magnesium uptake/ efflux
• Groups of genes → Membrane proteins

Gene

Coordinates: 1,032,063 → 1,033,397

Phenotypes of a mutant

• suppression of the growth defects of rplA and rplW mutants PubMed
• partial suppression of sporulation frequency of a rplA mutant PubMed

The protein

Protein family

• UPF0053 family(according to UniProt)

Paralogous protein(s)

• YqhB, YrkA, YugS, YhdT

Domains

• CNNM transmembrane domain (aa 1-201) (according to UniProt)
• DUF21 domain (aa 5-201)
• 2 CBS domains (aa 220-282, aa 284-344) (according to UniProt)

Structure

• 4HG0 (CorC from E. coli, corresponds to the CBS domains and the C-terminal transporter-associated domain)

Localization

• cell membrane (according to UniProt)

Expression and Regulation

Operons

• Genes: yhdQ-mpfA
  Description: PubMed

  Regulation

  • threefold induced in the presence of high Mg²⁺ concentrations PubMed

Biological materials

Mutant

• MGNA-A696 (yhdP::erm), available at the NBRP B. subtilis, Japan
• BKE09550 (ΔmpfA::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CAATTAGAACCTTCACTCTA, downstream forward: _UP4_TAATAAGAAAAGCACCTTGT
• BKK09550 (ΔmpfA::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CAATTAGAACCTTCACTCTA, downstream forward: _UP4_TAATAAGAAAAGCACCTTGT

Expression vectors

• pGP2931 (N-terminal His-tag, purification from E. coli, in pWH844), available in Jörg Stülke's lab

References

Loading